pMTU-DO-G418
(Plasmid
#160007)
-
Purpose(Empty Backbone) Low-copy expression vector for K. marxianus, G418 selection
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160007 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneConstructed from MoClo Yeast Toolkit (Kit # 1000000061) and our own yeast origin, also available as Addgene plasmid 125059
-
Backbone manufacturerPartially Addgene
- Backbone size (bp) 3932
-
Vector typeYeast Expression ; Kluyveromyces marxianus
- Promoter n/a
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer tttgctggccttttgctc
- 3′ sequencing primer gcagtttcatttgatgctcga
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMTU-DO-G418 was a gift from John Morrissey (Addgene plasmid # 160007 ; http://n2t.net/addgene:160007 ; RRID:Addgene_160007) -
For your References section:
Rational engineering of Kluyveromyces marxianus to create a chassis for the production of aromatic products. Rajkumar AS, Morrissey JP. Microb Cell Fact. 2020 Nov 11;19(1):207. doi: 10.1186/s12934-020-01461-7. 10.1186/s12934-020-01461-7 PubMed 33176787