pRaGE Pyl TAG GFP Y35TAG
(Plasmid
#160041)
-
PurposeEncodes for MmPyl tRNA synthetase/tRNA pair and for GFP reporter with TAG mutation at site 35, for unnatural amino acid incorporation into the GFP protein in Vibrio natriegens.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160041 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBEST
- Backbone size w/o insert (bp) 4714
- Total vector size (bp) 7890
-
Modifications to backboneIn addition to pBR322 origin and amp marker, we have introduced the 2micron yeast origin and URA3 marker to enable genetic engineering using yeast assembly.
-
Vector typeBacterial Expression, Synthetic Biology
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namePyrrolysyl tRNA synthetase (Methanosarcina mazei)
-
Alt nameMmPylRS
-
SpeciesMethanosarcina mazei
-
Insert Size (bp)1365
- Promoter Vibrio natriegens GluRS native promoter and terminator
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGGCTGGGAAGCATATTTG
- 3′ sequencing primer AACCATATCAATCTGTGTGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePyrrolysyl tRNA(cua) (Methanosarcina mazei)
-
Alt nameMmPyl-tRNA
-
SpeciesMethanosarcina mazei
-
Insert Size (bp)72
- Promoter Vibrio natriegens tRNAs native promoter and terminator
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGACAAATATCTGCATTAG
- 3′ sequencing primer TCTTCACCATGTCAAACATC (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namedeGFP
-
Insert Size (bp)714
-
MutationChanged tyrosine 35 to TAG stop-codon (Site number matches sequence without N-His-tag. Site 47 with N-His-tag)
- Promoter P70b promoter and T500 terminator
-
Tag
/ Fusion Protein
- His-tag (N terminal on insert)
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGAAGACTATCGCACCATCAG
- 3′ sequencing primer GATAAAGAAGACAGTCATAAGTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRaGE Pyl TAG GFP Y35TAG was a gift from Lital Alfonta (Addgene plasmid # 160041 ; http://n2t.net/addgene:160041 ; RRID:Addgene_160041) -
For your References section:
Genetic Code Expansion of Vibrio natriegens. Ozer E, Alfonta L. Front Bioeng Biotechnol. 2021 Feb 26;9:594429. doi: 10.3389/fbioe.2021.594429. eCollection 2021. 10.3389/fbioe.2021.594429 PubMed 33718334