pRaGE Pyl TAG GFP Y35TAG
(Plasmid #160041)

• Purpose: Encodes for MmPyl tRNA synthetase/tRNA pair and for GFP reporter with TAG mutation at site 35, for unnatural amino acid incorporation into the GFP protein in Vibrio natriegens.
• Depositing Lab: Lital Alfonta
• Publication: Ozer et al Front Bioeng Biotechnol. 2021 Feb 26;9:594429. doi: 10.3389/fbioe.2021.594429. eCollection 2021.

Backbone

• Vector backbone: pBEST
• Backbone size w/o insert (bp): 4714
• Total vector size (bp): 7890
• Modifications to backbone: In addition to pBR322 origin and amp marker, we have introduced the 2micron yeast origin and URA3 marker to enable genetic engineering using yeast assembly.
• Vector type: Bacterial Expression, Synthetic Biology
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Pyrrolysyl tRNA synthetase (Methanosarcina mazei)
• Alt name: MmPylRS
• Species: Methanosarcina mazei
• Insert Size (bp): 1365
• Promoter: Vibrio natriegens GluRS native promoter and terminator

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAGGCTGGGAAGCATATTTG
• 3′ sequencing primer: AACCATATCAATCTGTGTGG

Gene/Insert 2

• Gene/Insert name: Pyrrolysyl tRNA(cua) (Methanosarcina mazei)
• Alt name: MmPyl-tRNA
• Species: Methanosarcina mazei
• Insert Size (bp): 72
• Promoter: Vibrio natriegens tRNAs native promoter and terminator

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGACAAATATCTGCATTAG
• 3′ sequencing primer: TCTTCACCATGTCAAACATC

Gene/Insert 3

• Gene/Insert name: deGFP
• Insert Size (bp): 714
• Mutation: Changed tyrosine 35 to TAG stop-codon (Site number matches sequence without N-His-tag. Site 47 with N-His-tag)
• Promoter: P70b promoter and T500 terminator
• Tag / Fusion Protein:
  • His-tag (N terminal on insert)

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTGAAGACTATCGCACCATCAG
• 3′ sequencing primer: GATAAAGAAGACAGTCATAAGTGC

Resource Information

• Supplemental Documents:
  • pRaGE Pyl TAG GFP Y35TAG.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry