Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRaGE Pyl TAG GFP Y35TAG
(Plasmid #160041)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 160041 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBEST
  • Backbone size w/o insert (bp) 4714
  • Total vector size (bp) 7890
  • Modifications to backbone
    In addition to pBR322 origin and amp marker, we have introduced the 2micron yeast origin and URA3 marker to enable genetic engineering using yeast assembly.
  • Vector type
    Bacterial Expression, Synthetic Biology
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Pyrrolysyl tRNA synthetase (Methanosarcina mazei)
  • Alt name
    MmPylRS
  • Species
    Methanosarcina mazei
  • Insert Size (bp)
    1365
  • Promoter Vibrio natriegens GluRS native promoter and terminator

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGGCTGGGAAGCATATTTG
  • 3′ sequencing primer AACCATATCAATCTGTGTGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Pyrrolysyl tRNA(cua) (Methanosarcina mazei)
  • Alt name
    MmPyl-tRNA
  • Species
    Methanosarcina mazei
  • Insert Size (bp)
    72
  • Promoter Vibrio natriegens tRNAs native promoter and terminator

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGACAAATATCTGCATTAG
  • 3′ sequencing primer TCTTCACCATGTCAAACATC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    deGFP
  • Insert Size (bp)
    714
  • Mutation
    Changed tyrosine 35 to TAG stop-codon (Site number matches sequence without N-His-tag. Site 47 with N-His-tag)
  • Promoter P70b promoter and T500 terminator
  • Tag / Fusion Protein
    • His-tag (N terminal on insert)

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTGAAGACTATCGCACCATCAG
  • 3′ sequencing primer GATAAAGAAGACAGTCATAAGTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRaGE Pyl TAG GFP Y35TAG was a gift from Lital Alfonta (Addgene plasmid # 160041 ; http://n2t.net/addgene:160041 ; RRID:Addgene_160041)
  • For your References section:

    Genetic Code Expansion of Vibrio natriegens. Ozer E, Alfonta L. Front Bioeng Biotechnol. 2021 Feb 26;9:594429. doi: 10.3389/fbioe.2021.594429. eCollection 2021. 10.3389/fbioe.2021.594429 PubMed 33718334