Skip to main content

pRK5-α5last
(Plasmid #160270)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160270 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKR5
  • Backbone size w/o insert (bp) 4668
  • Total vector size (bp) 12783
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    α5last concatemer
  • Alt name
    α4-β2-α4-β2-α5 concatemer
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    8115
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer GCCTTTCTCTCCACAGGTGTCC
  • 3′ sequencing primer GTGAAATTTGTGATGCTATTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRK5-α5last was a gift from Pierre-Jean Corringer (Addgene plasmid # 160270 ; http://n2t.net/addgene:160270 ; RRID:Addgene_160270)
  • For your References section:

    Concatemers to re-investigate the role of alpha5 in alpha4beta2 nicotinic receptors. Prevost MS, Bouchenaki H, Barilone N, Gielen M, Corringer PJ. Cell Mol Life Sci. 2020 May 29. pii: 10.1007/s00018-020-03558-z. doi: 10.1007/s00018-020-03558-z. 10.1007/s00018-020-03558-z PubMed 32472188