pESC-NAT-Ago-Dcr
(Plasmid
#160381)
-
PurposeOverexpression of Ago-Dcr fusion protein in yeast
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160381 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepESC
- Backbone size w/o insert (bp) 7959
- Total vector size (bp) 13701
-
Vector typeYeast Expression
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAgo- Dcr
-
SpeciesS. cerevisiae (budding yeast); S.castelii
-
Insert Size (bp)3900
- Promoter GAL
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer NA
- 3′ sequencing primer NA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
AGO1 and DCR1 genes were amplified from S. castellii gDNA using primersatac gcggccgc aacgatgtcatccaattcgg+ and atac gcggccgc agcacataaactctttgttc, respectively.
Plasmid pESC-LEU was converted to leu2::NAT derivative via short-homology in vivo replacement using PCR product generated using primers AAGCAAGGATTTTCTTAACTTCTTCGGCGACAGCATCACCGACTTCGGTGc agc tga agc ttc gta cgc+tttttccaataggtggttagcaatcgtcttactttctaacttttcttacct agg cca cta gtg gat ctg and pAG25 template.
AGO1 was cloned into NotI site of pESC-NAT to yield pESC-NAT-AGO1 plasmid.
DCR1 was cloned into ApaI/XhoI site of pESC-NAT-AGO1 to yield pESC-NAT-AGO1-DCR1 plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pESC-NAT-Ago-Dcr was a gift from John McCusker (Addgene plasmid # 160381 ; http://n2t.net/addgene:160381 ; RRID:Addgene_160381)