pESC-NAT-Ago-Dcr
(Plasmid #160381)

• Purpose: Overexpression of Ago-Dcr fusion protein in yeast
• Depositing Lab: John McCusker
• Publication: Yeast viruses (unpublished)

Backbone

• Vector backbone: pESC
• Backbone size w/o insert (bp): 7959
• Total vector size (bp): 13701
• Vector type: Yeast Expression
• Selectable markers: Nourseothricin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ago- Dcr
• Species: S. cerevisiae (budding yeast); S.castelii
• Insert Size (bp): 3900
• Promoter: GAL

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: NA
• 3′ sequencing primer: NA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

AGO1 and DCR1 genes were amplified from S. castellii gDNA using primersatac gcggccgc aacgatgtcatccaattcgg+ and atac gcggccgc agcacataaactctttgttc, respectively.
Plasmid pESC-LEU was converted to leu2::NAT derivative via short-homology in vivo replacement using PCR product generated using primers AAGCAAGGATTTTCTTAACTTCTTCGGCGACAGCATCACCGACTTCGGTGc agc tga agc ttc gta cgc+tttttccaataggtggttagcaatcgtcttactttctaacttttcttacct agg cca cta gtg gat ctg and pAG25 template.
AGO1 was cloned into NotI site of pESC-NAT to yield pESC-NAT-AGO1 plasmid.
DCR1 was cloned into ApaI/XhoI site of pESC-NAT-AGO1 to yield pESC-NAT-AGO1-DCR1 plasmid.