pCAS-mak10 gRNA
(Plasmid
#160385)
-
PurposeExpresses guide RNA for targeting MAK10 in yeast
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160385 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAS
-
Backbone manufacturerAddgene $ 60847
- Backbone size w/o insert (bp) 8761
- Total vector size (bp) 8743
-
Vector typeYeast Expression
-
Selectable markersG418
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemak10 gRNA
-
Alt nameMAK10
-
Alt nameYEL053C
-
gRNA/shRNA sequenceTTTCAATTAGCTCATCCAGG
-
SpeciesS. cerevisiae (budding yeast)
- Promoter RNA pol III promoter (tRNA-Tyr)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer NA
- 3′ sequencing primer NA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAS-mak10 gRNA was a gift from John McCusker (Addgene plasmid # 160385 ; http://n2t.net/addgene:160385 ; RRID:Addgene_160385)