PJD1223
              
              
                (Plasmid
                
                #160390)
              
            
            
            
          - 
            PurposeEncodes L-A cDNA for curing L-A virus and Parent for pJD1223-NAT
- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160390 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonePJD1223
- 
              Backbone manufacturerJ Virol . 1993 May;67(5):2764-71. doi: 10.1128/JVI.67.5.2764-2771.1993.
- Backbone size w/o insert (bp) 9854
- Total vector size (bp) 12223
- 
              Vector typeYeast Expression
- 
                Selectable markersNourseothricin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameL-A Gag-Pol
- 
                    SpeciesS. cerevisiae (budding yeast)
- 
                  Insert Size (bp)4516
- Promoter TRP1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer NA
- 3′ sequencing primer NA (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pJD1223-NAT was constructed by short-homology in vivo replacement of TRP1 on pJD1223 (J Virol
. 1993 May;67(5):2764-71) with NAT PCR product generated using primers TATTGAGCACGTGAGTATACGTGATTAAGCACACAAAGGCAGCTTGGAGTcagctgaagcttcgtacgc and
caagtgcacaaacaatacttaaataaatactactcagtaataacctattttaggccactagtggatctg from pAG25.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: PJD1223 was a gift from John McCusker (Addgene plasmid # 160390 ; http://n2t.net/addgene:160390 ; RRID:Addgene_160390)
 
    
 
                         
             
            