-
PurposeWheat GRF4-GIF1 chimera in pDONR-zeo
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160392 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDONR-zeo
- Backbone size w/o insert (bp) 2076
- Total vector size (bp) 3987
-
Vector typeEntry clon
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namewheat GRF4-GIF1 chimera
-
Specieswheat
-
Insert Size (bp)1911
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGGCGATGCCGTATGCCTC
- 3′ sequencing primer CTAGCTTCCTTCCTCCTCGGT
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
JD553 was a gift from Jorge Dubcovsky (Addgene plasmid # 160392 ; http://n2t.net/addgene:160392 ; RRID:Addgene_160392) -
For your References section:
A GRF-GIF chimeric protein improves the regeneration efficiency of transgenic plants. Debernardi JM, Tricoli DM, Ercoli MF, Hayta S, Ronald P, Palatnik JF, Dubcovsky J. Nat Biotechnol. 2020 Oct 12. pii: 10.1038/s41587-020-0703-0. doi: 10.1038/s41587-020-0703-0. 10.1038/s41587-020-0703-0 PubMed 33046875