pHX_HDR_hPAX7_IRES-EGFP-PGK-Neo
(Plasmid
#160458)
-
PurposeHomology-directed recombination donor vector for EGFP reporter knock-in to human PAX7 3' UTR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160458 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneOct4-IRES-eGFP-PGK-Neo
-
Backbone manufacturer48681
- Backbone size w/o insert (bp) 5978
- Total vector size (bp) 7328
-
Modifications to backboneThe homology arms of mouse Oct4 in the backbone vector are replaced by human PAX7 homology arms
-
Vector typeInsertion of a fluorescent reporter through homology-directed recombination
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namePAX7 Left/5' Homology Arm
-
SpeciesH. sapiens (human)
-
Insert Size (bp)650
-
GenBank IDNM_001135254
-
Entrez GenePAX7 (a.k.a. CMYP19, HUP1, MYOSCO, PAX7B, RMS2)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer M13R: CAGGAAACAGCTATGAC
- 3′ sequencing primer AAAGGAATGCAAGGTCTGTT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePAX7 Right/3' Homology Arm
-
SpeciesH. sapiens (human)
-
Insert Size (bp)700
-
GenBank IDNM_001135254
-
Entrez GenePAX7 (a.k.a. CMYP19, HUP1, MYOSCO, PAX7B, RMS2)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer NeoF: CGTTGGCTACCCGTGATATT
- 3′ sequencing primer M13(-47): GTTTTCCCAGTCACGAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHX_HDR_hPAX7_IRES-EGFP-PGK-Neo was a gift from April Pyle (Addgene plasmid # 160458 ; http://n2t.net/addgene:160458 ; RRID:Addgene_160458) -
For your References section:
Generation of PAX7 Reporter Cells to Investigate Skeletal Myogenesis from Human Pluripotent Stem Cells. Xi H, Young CS, Pyle AD. STAR Protoc. 2020 Nov 5;1(3):100158. doi: 10.1016/j.xpro.2020.100158. eCollection 2020 Dec 18. 10.1016/j.xpro.2020.100158 PubMed 33377052