pCDH-CAG-NCreIntN-T2A-mTagBFP2
(Plasmid
#160500)
-
PurposeExpresses NCreIntN in mammalian cells in split intein-mediated split-Cre recombinase applications
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160500 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCDH
-
Backbone manufacturerSystem Biosciences
- Backbone size w/o insert (bp) 8550
- Total vector size (bp) 9107
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNCreIntN
-
SpeciesSynthetic
-
Insert Size (bp)555
- Promoter CAG
-
Tag
/ Fusion Protein
- mTagBFP2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cggatctcgacggtatcggt
- 3′ sequencing primer tcatcactcgttgcatcgac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-CAG-NCreIntN-T2A-mTagBFP2 was a gift from Shawn Je (Addgene plasmid # 160500 ; http://n2t.net/addgene:160500 ; RRID:Addgene_160500) -
For your References section:
Neural circuit analysis using a novel intersectional split intein-mediated split-Cre recombinase system. Khoo ATT, Kim PJ, Kim HM, Je HS. Mol Brain. 2020 Jul 2;13(1):101. doi: 10.1186/s13041-020-00640-2. 10.1186/s13041-020-00640-2 PubMed 32616061