Ad:2CMV_A2R2-N25Ctr
(Plasmid
#122243)
-
PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backbone
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122243 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepShuttle-CMV
- Backbone size w/o insert (bp) 7469
- Total vector size (bp) 12749
-
Vector typeMammalian Expression, Adenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameC-terminal end of Nesprin-3 w/o Kash
-
Alt nameSyne3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)120
-
Mutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGGCCAACAACTTCGCCCGCTCCTTTGCGCTCATGCTTCGGTACAATGGCCCCCCGCCCACC)
-
Entrez GeneSyne3 (a.k.a. KASH3, nesprin-3)
- Promoter CMV
-
Tags
/ Fusion Proteins
- mNeptune2.5 (N terminal on insert)
- Signal Peptide (TOR1A, NM_000113.2) (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer n/a (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameActinin alpha 2
-
Alt nameActn2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2682
-
GenBank IDNM_033268.4
-
Entrez GeneActn2 (a.k.a. 1110008F24Rik)
- Promoter CMV
-
Tag
/ Fusion Protein
- mRuby2 (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer n/a (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Dominant negative Kash construct is comprised of the C-terminal end of Nesprin-3, including the transmembrane but excluding the Kash domain, and fused to Nesprin2.5 for visual location and to the signal peptide of TOR1A (NM_000113.2) for membrane integration. This vector is meant as integration defective control (into LINC complex) for the vector Ad:2CMV_A2R2-N25K3 (122242). Please note the L451V substitution in Actinin alpha 2 has no functional consequences.
Please visit https://www.biorxiv.org/content/early/2018/10/29/455600 for BioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ad:2CMV_A2R2-N25Ctr was a gift from Corey Neu (Addgene plasmid # 122243 ; http://n2t.net/addgene:122243 ; RRID:Addgene_122243) -
For your References section:
Nuclear deformation guides chromatin reorganization in cardiac development and disease. Seelbinder B, Ghosh S, Schneider SE, Scott AK, Berman AG, Goergen CJ, Margulies KB, Bedi KC Jr, Casas E, Swearingen AR, Brumbaugh J, Calve S, Neu CP. Nat Biomed Eng. 2021 Dec;5(12):1500-1516. doi: 10.1038/s41551-021-00823-9. Epub 2021 Dec 2. 10.1038/s41551-021-00823-9 PubMed 34857921