pDGB3 alpha1 P35S:AsCas12a:T35S (GB1440)
(Plasmid
#160610)
-
PurposeTranscriptional unit for the expression of the AsCas12a in plant systems driven by the CaMV35s promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160610 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDGB3_alpha1
-
Backbone manufacturerself-made; derived from pCambia1302 generated at the Cambia Institute
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameP35s:AsCas12a:T35s
-
SpeciesLachnospiraceae
-
Insert Size (bp)5325
-
MutationBsaI and BsmBI sites removed
- Promoter P35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GGTGGCAGGATATATTGTGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Compatible with GoldenBraid; insert can be released with BsmBI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB3 alpha1 P35S:AsCas12a:T35S (GB1440) was a gift from Diego Orzaez (Addgene plasmid # 160610 ; http://n2t.net/addgene:160610 ; RRID:Addgene_160610) -
For your References section:
Assessment of Cas12a-mediated gene editing efficiency in plants. Bernabe-Orts JM, Casas-Rodrigo I, Minguet EG, Landolfi V, Garcia-Carpintero V, Gianoglio S, Vazquez-Vilar M, Granell A, Orzaez D. Plant Biotechnol J. 2019 Apr 5. doi: 10.1111/pbi.13113. 10.1111/pbi.13113 PubMed 30950179