pEGB3_alpha2 35:PhyB:VP16  (GB2745)
              
              
                (Plasmid
                
                #160630)
              
            
            
            
          - 
            PurposeTU for the expression of chimeric construct comprising the N-terminal fragment of A. thaliana PhyB (amino acids 1-650) fused to the VP16 activation domain and a nuclear localization sequence. Part of a red light-controlled synthetic genetic switch
- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160630 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepDGB3_alpha1
- 
              Backbone manufacturerself-made; derived from pCambia1302 generated at the Cambia Institute
- 
              Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert namePhyBVP16
- 
                    SpeciesSynthetic
- 
                  Insert Size (bp)3936
- 
                  MutationBsaI and BsmBI sites removed
- Promoter 35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GGTGGCAGGATATATTGTGG (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Compatible with GoldenBraid; insert can be released with BsmBI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pEGB3_alpha2 35:PhyB:VP16 (GB2745) was a gift from Diego Orzaez (Addgene plasmid # 160630 ; http://n2t.net/addgene:160630 ; RRID:Addgene_160630)
 
    
