pEGB3_alpha1 gRNAs 2.1 P35S -104 -162 -229 (GB2759)
(Plasmid
#160631)
-
PurposeMultiplex construct with 2.1 aptamer in scf to target -104 -162 -229 positions of 35s promoter.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160631 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDGB2_alpha2
-
Backbone manufacturerself-made; derived from pCambia1302 generated at the Cambia Institute
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA
-
SpeciesSynthetic
-
Insert Size (bp)2834
-
MutationBsaI and BsmBI sites removed
- Promoter U626
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GGTGGCAGGATATATTGTGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Compatible with GoldenBraid; insert can be released with BsmBI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGB3_alpha1 gRNAs 2.1 P35S -104 -162 -229 (GB2759) was a gift from Diego Orzaez (Addgene plasmid # 160631 ; http://n2t.net/addgene:160631 ; RRID:Addgene_160631)