pDGB3_Omega1_Pnos:ER:lexABD:GAL4AD:T35s-OplexA:mini35S:phi31:Tnos (GB1677)
(Plasmid
#160641)
-
PurposeModule for estradiol-inducible exp of the PhiC31 integrase gene. Includes TU for constitutive exp of an estradiol-inducible transcription activator and TU for estradiol-inducible exp of PhiC31.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160641 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGB3_omega1
-
Backbone manufacturerself-made; derived from pCambia1302 generated at the Cambia Institute
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameERLexABDGal4AD / PhiC31
-
SpeciesSynthetic
-
Insert Size (bp)5027
-
MutationBsaI and BsmBI sites removed
- Promoter Pnos
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer caacctctcgggcttctgga
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Compatible with GoldenBraid; insert can be released with BsaI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB3_Omega1_Pnos:ER:lexABD:GAL4AD:T35s-OplexA:mini35S:phi31:Tnos (GB1677) was a gift from Diego Orzaez (Addgene plasmid # 160641 ; http://n2t.net/addgene:160641 ; RRID:Addgene_160641) -
For your References section:
A memory switch for plant synthetic biology based on the phage varphiC31 integration system. Bernabe-Orts JM, Quijano-Rubio A, Vazquez-Vilar M, Mancheno-Bonillo J, Moles-Casas V, Selma S, Gianoglio S, Granell A, Orzaez D. Nucleic Acids Res. 2020 Apr 6;48(6):3379-3394. doi: 10.1093/nar/gkaa104. 10.1093/nar/gkaa104 PubMed 32083668