10TALE_Pmin_fLuc
(Plasmid
#160663)
-
PurposeExpression of the firefly luciferase reporter upon binding of a transcriptional activator to target sites. The plasmid contains 10 copies of target sites for the TALEN1257 DNA-binding domain
-
Depositing Lab
-
Depositing OrganizationNational Institute of Chemistry
Located in Slovenia -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160663 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 160663-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 160663-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL4.16
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name10TALE_Pmin_fLuc
-
SpeciesSynthetic
- Promoter minimal
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGTGAATCGATAGTACTAACATAC
- 3′ sequencing primer cactgcattctagttgtggtttgtcc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGaber, R., Lebar, T., Majerle, A. et al. Designable DNA-binding domains enable construction of logic circuits in mammalian cells. Nat Chem Biol 10, 203–208 (2014). https://doi.org/10.1038/nchembio.1433
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 160663-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 160663-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
10TALE_Pmin_fLuc was a gift from Roman Jerala (Addgene plasmid # 160663 ; http://n2t.net/addgene:160663 ; RRID:Addgene_160663) -
For your References section:
Engineering and Rewiring of a Calcium-Dependent Signaling Pathway. Mesko M, Lebar T, Dekleva P, Jerala R, Bencina M. ACS Synth Biol. 2020 Aug 21;9(8):2055-2065. doi: 10.1021/acssynbio.0c00133. Epub 2020 Jul 20. 10.1021/acssynbio.0c00133 PubMed 32643923
