Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

10TALE_Pmin_fLuc
(Plasmid #160663)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 160663 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL4.16
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    10TALE_Pmin_fLuc
  • Species
    Synthetic
  • Promoter minimal

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTGTGAATCGATAGTACTAACATAC
  • 3′ sequencing primer cactgcattctagttgtggtttgtcc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Gaber, R., Lebar, T., Majerle, A. et al. Designable DNA-binding domains enable construction of logic circuits in mammalian cells. Nat Chem Biol 10, 203–208 (2014). https://doi.org/10.1038/nchembio.1433

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    10TALE_Pmin_fLuc was a gift from Roman Jerala (Addgene plasmid # 160663 ; http://n2t.net/addgene:160663 ; RRID:Addgene_160663)
  • For your References section:

    Engineering and Rewiring of a Calcium-Dependent Signaling Pathway. Mesko M, Lebar T, Dekleva P, Jerala R, Bencina M. ACS Synth Biol. 2020 Aug 21;9(8):2055-2065. doi: 10.1021/acssynbio.0c00133. Epub 2020 Jul 20. 10.1021/acssynbio.0c00133 PubMed 32643923