pJMP2832
(Plasmid
#160672)
-
PurposeMobile CRISPRi sfGFP 'test', gmc6 sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160672 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneR6Kγ
-
Vector typeBacterial Expression
-
Selectable markersChloramphenicol
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)BW25141
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegmc6 (gfp) sgRNA
-
gRNA/shRNA sequenceCATCTAATTCAACAAGAATT
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJMP2832 was a gift from Jason Peters (Addgene plasmid # 160672 ; http://n2t.net/addgene:160672 ; RRID:Addgene_160672) -
For your References section:
Programmable Gene Knockdown in Diverse Bacteria Using Mobile-CRISPRi. Banta AB, Ward RD, Tran JS, Bacon EE, Peters JM. Curr Protoc Microbiol. 2020 Dec;59(1):e130. doi: 10.1002/cpmc.130. 10.1002/cpmc.130 PubMed 33332762