Skip to main content
Addgene

MDH1-PGK-GFP microRNA-10b
(Plasmid #16070)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 16070 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MDH1-PGK-GFP 2.0
  • Backbone size w/o insert (bp) 6963
  • Vector type
    Mammalian Expression, Retroviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    microRNA-10b
  • Alt name
    miR-10b
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    315
  • Entrez Gene
    MIR10B (a.k.a. MIRN10B, hsa-mir-10b, miRNA10B, mir-10b)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer EGFP-C
  • 3′ sequencing primer ggatcccaatatttgcatgtcgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The miRNA gene was PCR-amplified from normal human genomic DNA and cloned into the MDH1-PGK-GFP 2.0 retroviral vector. It includes miR-10b stem-loop and ~100bp flanking sequences on both sides.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MDH1-PGK-GFP microRNA-10b was a gift from Bob Weinberg (Addgene plasmid # 16070 ; http://n2t.net/addgene:16070 ; RRID:Addgene_16070)
  • For your References section:

    Tumour invasion and metastasis initiated by microRNA-10b in breast cancer. Ma L, Teruya-Feldstein J, Weinberg RA. Nature. 2007 Oct 11. 449(7163):682-8. 10.1038/nature06174 PubMed 17898713