pAAV-UBC-S2-cAMPr
(Plasmid
#160723)
-
PurposeSignaling reporter island (SiRI) construct for spatially multiplexed imaging. Contains GFP-based fluorescent reporter cAMPr (cAMP indicator), HA tag, and S2 protein scaffold.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160723 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-UBC
-
Backbone manufacturerEpoch Life Science
- Backbone size w/o insert (bp) 4178
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameS2-cAMPr
-
Alt nameS2-cAMPr-HA
-
Alt nameSiRI-S2-cAMPr
-
SpeciesSynthetic
-
Insert Size (bp)3558
-
MutationN/A
-
GenBank IDMT449929
- Promoter Human ubiquitin C (UBC) promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATCGCTGTGATCGTCACTTGG
- 3′ sequencing primer WPRE-R
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The pAAV-UBC backbone contains WHP Post-transcriptional Response Element (WPRE) at 3'-UTR. 5' cloning site: SpeI (not destroyed), 3' cloning site: HindIII (not destroyed).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-UBC-S2-cAMPr was a gift from Edward Boyden (Addgene plasmid # 160723 ; http://n2t.net/addgene:160723 ; RRID:Addgene_160723) -
For your References section:
Spatial Multiplexing of Fluorescent Reporters for Imaging Signaling Network Dynamics. Linghu C, Johnson SL, Valdes PA, Shemesh OA, Park WM, Park D, Piatkevich KD, Wassie AT, Liu Y, An B, Barnes SA, Celiker OT, Yao CC, Yu CJ, Wang R, Adamala KP, Bear MF, Keating AE, Boyden ES. Cell. 2020 Nov 17. pii: S0092-8674(20)31399-4. doi: 10.1016/j.cell.2020.10.035. 10.1016/j.cell.2020.10.035 PubMed 33232692