Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-UBC-S1-jRCaMP1a
(Plasmid #160728)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 160728 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-UBC
  • Backbone manufacturer
    Epoch Life Science
  • Backbone size w/o insert (bp) 4178
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    S1-jRCaMP1a
  • Alt name
    S1-jRCaMP1a-Xpress
  • Alt name
    SiRI-S1-jRCaMP1a
  • Species
    Synthetic
  • Insert Size (bp)
    2106
  • Mutation
    N/A
  • GenBank ID
    MT449935
  • Promoter Human ubiquitin C (UBC) promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATCGCTGTGATCGTCACTTGG
  • 3′ sequencing primer WPRE-R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The pAAV-UBC backbone contains WHP Post-transcriptional Response Element (WPRE) at 3'-UTR. 5' cloning site: SpeI (not destroyed), 3' cloning site: HindIII (not destroyed).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-UBC-S1-jRCaMP1a was a gift from Edward Boyden (Addgene plasmid # 160728 ; http://n2t.net/addgene:160728 ; RRID:Addgene_160728)
  • For your References section:

    Spatial Multiplexing of Fluorescent Reporters for Imaging Signaling Network Dynamics. Linghu C, Johnson SL, Valdes PA, Shemesh OA, Park WM, Park D, Piatkevich KD, Wassie AT, Liu Y, An B, Barnes SA, Celiker OT, Yao CC, Yu CJ, Wang R, Adamala KP, Bear MF, Keating AE, Boyden ES. Cell. 2020 Nov 17. pii: S0092-8674(20)31399-4. doi: 10.1016/j.cell.2020.10.035. 10.1016/j.cell.2020.10.035 PubMed 33232692