pXWS40tetO
(Plasmid
#160827)
-
Purpose40 repeats of tetO sponge
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160827 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSB3K3
- Backbone size w/o insert (bp) 2672
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name(40 X tetO)-t
-
SpeciesSynthetic
-
Insert Size (bp)1969
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer ATTACCGCCTTTGAGTGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid may be prone to recombination. It is recommended to screen multiple DNA preparations from cultures started from single colonies.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXWS40tetO was a gift from Baojun Wang (Addgene plasmid # 160827 ; http://n2t.net/addgene:160827 ; RRID:Addgene_160827) -
For your References section:
Synthetic protein-binding DNA sponge as a tool to tune gene expression and mitigate protein toxicity. Wan X, Pinto F, Yu L, Wang B. Nat Commun. 2020 Nov 24;11(1):5961. doi: 10.1038/s41467-020-19552-9. 10.1038/s41467-020-19552-9 PubMed 33235249