Skip to main content
Addgene

pXWS80LBS
(Plasmid #160840)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160840 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSB3K3
  • Backbone size w/o insert (bp) 2672
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    (80 X LBS)-t
  • Species
    Synthetic
  • Insert Size (bp)
    5489

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer TGCCACCTGACGTCTAAGAA
  • 3′ sequencing primer ATTACCGCCTTTGAGTGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid may be prone to recombination. It is recommended to screen multiple DNA preparations from cultures started from single colonies.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXWS80LBS was a gift from Baojun Wang (Addgene plasmid # 160840 ; http://n2t.net/addgene:160840 ; RRID:Addgene_160840)
  • For your References section:

    Synthetic protein-binding DNA sponge as a tool to tune gene expression and mitigate protein toxicity. Wan X, Pinto F, Yu L, Wang B. Nat Commun. 2020 Nov 24;11(1):5961. doi: 10.1038/s41467-020-19552-9. 10.1038/s41467-020-19552-9 PubMed 33235249