-
PurposeRUBY under the control of At2S3 promoter/marker for Arabidopsis transgenes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160906 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHDE
- Backbone size w/o insert (bp) 9346
- Total vector size (bp) 13986
-
Vector typePlant Expression
-
Selectable markersSpectinomycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRUBY and At2S3 promoter
-
SpeciesSynthetic; Arabidopsis
-
Insert Size (bp)4640
- Promoter At2S3
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGTCAAACACTGATAGTTTtaagctggcacaactatatttcc
- 3′ sequencing primer GCTTACTCAGTTAGGTCTAGCTTATCTTTAATCATATTCCATAGTCCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
At2S3:RUBY was a gift from Yunde Zhao (Addgene plasmid # 160906 ; http://n2t.net/addgene:160906 ; RRID:Addgene_160906) -
For your References section:
A reporter for noninvasively monitoring gene expression and plant transformation. He Y, Zhang T, Sun H, Zhan H, Zhao Y. Hortic Res. 2020 Sep 19;7:152. doi: 10.1038/s41438-020-00390-1. eCollection 2020. 10.1038/s41438-020-00390-1 PubMed 33024566