-
PurposeContains 10 constitutively expressed guide RNAs and CAG-GFP-CARLIN array sequence for DNA barcoding (when used in combination with Cas9)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160928 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBS31
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 12710
-
Vector typeMammalian Expression, Mouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCARLIN gRNAs and CAG-GFP-CARLIN array
-
Insert Size (bp)4502
- Promoter U6 promoter for gRNAs; CAG promoter for GFP
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CARLIN array fw: GAGCTGTACAAGTAAGCGGC
- 3′ sequencing primer CARLIN array rv: GCAACTAGAAGGCACAGTCG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS31-cCARLIN was a gift from Fernando Camargo (Addgene plasmid # 160928 ; http://n2t.net/addgene:160928 ; RRID:Addgene_160928) -
For your References section:
An Engineered CRISPR-Cas9 Mouse Line for Simultaneous Readout of Lineage Histories and Gene Expression Profiles in Single Cells. Bowling S, Sritharan D, Osorio FG, Nguyen M, Cheung P, Rodriguez-Fraticelli A, Patel S, Yuan WC, Fujiwara Y, Li BE, Orkin SH, Hormoz S, Camargo FD. Cell. 2020 Jun 11;181(6):1410-1422.e27. doi: 10.1016/j.cell.2020.04.048. Epub 2020 May 14. 10.1016/j.cell.2020.04.048 PubMed 32413320