lentiCRISPR v2-Nr4a1sgRNA1
(Plasmid
#160945)
-
PurposeGuide RNA 1 to generate Nr4a1 knockout by CRISPR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160945 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerAddgene 52961
- Backbone size w/o insert (bp) 14873
- Total vector size (bp) 13013
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNr4a1 gRNA 1
-
gRNA/shRNA sequenceCCGGGTAGCAGCCGTACACC
-
SpeciesM. musculus (mouse)
-
Entrez GeneNr4a1 (a.k.a. GFRP1, Gfrp, Hbr-1, Hbr1, Hmr, N10, NGFI-B, NGFIB, NP10, NUR77-1, NUR77-2, TIS1, TR3, nur77)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmbI (destroyed during cloning)
- 3′ cloning site BsmbI (destroyed during cloning)
- 5′ sequencing primer LentiV2 SeqF: cgggtttattacagggacagca (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPR v2-Nr4a1sgRNA1 was a gift from Matthew Steinhauser (Addgene plasmid # 160945 ; http://n2t.net/addgene:160945 ; RRID:Addgene_160945) -
For your References section:
Targeting nuclear receptor NR4A1-dependent adipocyte progenitor quiescence promotes metabolic adaptation to obesity. Zhang Y, Federation AJ, Kim S, O'Keefe JP, Lun M, Xiang D, Brown JD, Steinhauser ML. J Clin Invest. 2018 Nov 1;128(11):4898-4911. doi: 10.1172/JCI98353. Epub 2018 Oct 2. 10.1172/JCI98353 PubMed 30277475