Skip to main content
Addgene

pMKO.1-shBub1
(Plasmid #160948)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160948 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMKO.1 puro
  • Backbone manufacturer
    Addgene 8452
  • Backbone size w/o insert (bp) 6340
  • Total vector size (bp) 6369
  • Vector type
    Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bub1 shRNA
  • gRNA/shRNA sequence
    TRCN0000344980: CGCTATCAGAATGCTTTACAT
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Bub1 (a.k.a. AL022991, Bub1a, C80208, D2Xrf8, D2Xrf87)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer hU6
  • 3′ sequencing primer pMKO.1 Rev: GCTTGTACTCGGTCATGGTAAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMKO.1-shBub1 was a gift from Matthew Steinhauser (Addgene plasmid # 160948 ; http://n2t.net/addgene:160948 ; RRID:Addgene_160948)
  • For your References section:

    Targeting nuclear receptor NR4A1-dependent adipocyte progenitor quiescence promotes metabolic adaptation to obesity. Zhang Y, Federation AJ, Kim S, O'Keefe JP, Lun M, Xiang D, Brown JD, Steinhauser ML. J Clin Invest. 2018 Nov 1;128(11):4898-4911. doi: 10.1172/JCI98353. Epub 2018 Oct 2. 10.1172/JCI98353 PubMed 30277475