Skip to main content

modified pcAT7-Glo1
(Plasmid #160996)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160996 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGGS
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 6955
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hemoglobin subunit beta
  • Alt name
    HBB
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1600
  • Mutation
    Repeated intron 1 with 40 nucelotide deletion
  • GenBank ID
    NM_000518
  • Entrez Gene
    HBB (a.k.a. CD113t-C, ECYT6, beta-globin)
  • Promoter CAG

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The original version of this plasmid was received from Kristen Lynch at University of Pennsylvania. A 40 bp deletion in intron 1 was made in intron 1 compared to the original pcAT7-Glo1.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cloning for initial Vex-seq inserts is between the PstI and XbaI sites. The second step for generating the final splicing reporter involves PCR amplifying intron 2 and exon 3 from modified pcAT7-Glo1 using GTGTGGAAGTCTCAGGATCG and AACGGGCCCTCTAGAGC and digesting with XbaI and MfeI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    modified pcAT7-Glo1 was a gift from Brenton Graveley (Addgene plasmid # 160996 ; http://n2t.net/addgene:160996 ; RRID:Addgene_160996)
  • For your References section:

    Vex-seq: high-throughput identification of the impact of genetic variation on pre-mRNA splicing efficiency. Adamson SI, Zhan L, Graveley BR. Genome Biol. 2018 Jun 1;19(1):71. doi: 10.1186/s13059-018-1437-x. 10.1186/s13059-018-1437-x PubMed 29859120