pJB003 ZF1/2x6-C 3xFLAG-NLS-VP16-FRB
(Plasmid
#161546)
-
PurposeInducible expression of 3xFLAG-NLS-VP16-FRB under the ZF1/2x6-C promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 161546 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPD152 Reporter Template v2
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3xFLAG-NLS-VP16-FRB
-
SpeciesSynthetic
- Promoter ZF1/2x6-C
-
Tag
/ Fusion Protein
- 3x-FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGACACGGAAATGTTGAATAC
- 3′ sequencing primer CAGTGGGAGTGGCACCTTCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJB003 ZF1/2x6-C 3xFLAG-NLS-VP16-FRB was a gift from Joshua Leonard (Addgene plasmid # 161546 ; http://n2t.net/addgene:161546 ; RRID:Addgene_161546) -
For your References section:
Model-guided design of mammalian genetic programs. Muldoon JJ, Kandula V, Hong M, Donahue PS, Boucher JD, Bagheri N, Leonard JN. Sci Adv. 2021 Feb 19;7(8). pii: 7/8/eabe9375. doi: 10.1126/sciadv.abe9375. Print 2021 Feb. 10.1126/sciadv.abe9375 PubMed 33608279