pCfB9339 (pgRNA_VII-1_NatMX)
(Plasmid
#161591)
-
PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site VII-1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161591 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTAJAK-71 (pESC-NatMXsyn-USER)
-
Vector typeYeast Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameguiding RNA
-
gRNA/shRNA sequenceGTACTGCATGATATATTCAA
-
SpeciesS. cerevisiae (budding yeast)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCfB9339 (pgRNA_VII-1_NatMX) was a gift from Irina Borodina (Addgene plasmid # 161591 ; http://n2t.net/addgene:161591 ; RRID:Addgene_161591) -
For your References section:
Expansion of EasyClone-MarkerFree toolkit for Saccharomyces cerevisiae genome with new integration sites. Babaei M, Sartori L, Karpukhin A, Abashkin D, Matrosova E, Borodina I. FEMS Yeast Res. 2021 May 11;21(4). pii: 6249452. doi: 10.1093/femsyr/foab027. 10.1093/femsyr/foab027 PubMed 33893795