-
PurposeRhamnose-inducible expression of 8xHIS-ABE8e in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 161788 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepD881-SR
-
Backbone manufacturerAtum
- Backbone size w/o insert (bp) 2250
- Total vector size (bp) 7095
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor expression of protein, grow in BL21 star bacteria. After reaching log phase at 37 degrees C, cold shock followed by induction with 0.8% rhamnose and growth at 18 degrees C overnight is recommended.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameABE8e base editor
-
Alt nameABE8e
-
SpeciesSynthetic
-
Insert Size (bp)4845
- Promoter pRhaBAD
-
Tags
/ Fusion Proteins
- 8xHIS (N terminal on insert)
- BPNLS (N terminal on insert)
- BPNLS (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGAATTCAGGCGCTTTTTAG
- 3′ sequencing primer AACGATCTCAAGAAGATCATC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pABE8e-protein was a gift from David Liu (Addgene plasmid # 161788 ; http://n2t.net/addgene:161788 ; RRID:Addgene_161788) -
For your References section:
Precision genome editing using cytosine and adenine base editors in mammalian cells. Huang TP, Newby GA, Liu DR. Nat Protoc. 2021 Feb;16(2):1089-1128. doi: 10.1038/s41596-020-00450-9. Epub 2021 Jan 18. 10.1038/s41596-020-00450-9 PubMed 33462442