lentiCRISPR v2-sgSLC7A11/xCT-1
(Plasmid
#161818)
-
Purposeknock out SLC7A11/xCT in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161818 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 12000
- Total vector size (bp) 12000
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSLC7A11 solute carrier family 7 member 11 xCT
-
gRNA/shRNA sequenceATGAGCTTGATCGCAAGTTC
-
SpeciesH. sapiens (human)
-
GenBank IDNM_014331.4
-
Entrez GeneSLC7A11 (a.k.a. CCBR1, xCT)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPR v2-sgSLC7A11/xCT-1 was a gift from Boyi Gan (Addgene plasmid # 161818 ; http://n2t.net/addgene:161818 ; RRID:Addgene_161818) -
For your References section:
Cystine transporter regulation of pentose phosphate pathway dependency and disulfide stress exposes a targetable metabolic vulnerability in cancer. Liu X, Olszewski K, Zhang Y, Lim EW, Shi J, Zhang X, Zhang J, Lee H, Koppula P, Lei G, Zhuang L, You MJ, Fang B, Li W, Metallo CM, Poyurovsky MV, Gan B. Nat Cell Biol. 2020 Apr;22(4):476-486. doi: 10.1038/s41556-020-0496-x. Epub 2020 Mar 30. 10.1038/s41556-020-0496-x PubMed 32231310