-
PurposeEepresses SLC7A11 (also named xCT) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170427 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneplenti6-V5
- Backbone size w/o insert (bp) 8687
- Total vector size (bp) 10190
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesolute carrier family 7 member 11
-
Alt nameCystine/glutamate transporter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1503
-
GenBank IDNM_014331
-
Entrez GeneSLC7A11 (a.k.a. CCBR1, xCT)
-
Tag
/ Fusion Protein
- V5 (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGCAGTGGCAGTGACCTTT
- 3′ sequencing primer GGCAACAAAGATCGGAACTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plenti6-SLC7A11/xCT-V5 was a gift from Boyi Gan (Addgene plasmid # 170427 ; http://n2t.net/addgene:170427 ; RRID:Addgene_170427) -
For your References section:
The glutamate/cystine antiporter SLC7A11/xCT enhances cancer cell dependency on glucose by exporting glutamate. Koppula P, Zhang Y, Shi J, Li W, Gan B. J Biol Chem. 2017 Aug 25;292(34):14240-14249. doi: 10.1074/jbc.M117.798405. Epub 2017 Jun 19. 10.1074/jbc.M117.798405 PubMed 28630042