Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

plenti6-SLC7A11/xCT-V5
(Plasmid #170427)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 170427 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    plenti6-V5
  • Backbone size w/o insert (bp) 8687
  • Total vector size (bp) 10190
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    solute carrier family 7 member 11
  • Alt name
    Cystine/glutamate transporter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1503
  • GenBank ID
    NM_014331
  • Entrez Gene
    SLC7A11 (a.k.a. CCBR1, xCT)
  • Tag / Fusion Protein
    • V5 (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGCAGTGGCAGTGACCTTT
  • 3′ sequencing primer GGCAACAAAGATCGGAACTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    plenti6-SLC7A11/xCT-V5 was a gift from Boyi Gan (Addgene plasmid # 170427 ; http://n2t.net/addgene:170427 ; RRID:Addgene_170427)
  • For your References section:

    The glutamate/cystine antiporter SLC7A11/xCT enhances cancer cell dependency on glucose by exporting glutamate. Koppula P, Zhang Y, Shi J, Li W, Gan B. J Biol Chem. 2017 Aug 25;292(34):14240-14249. doi: 10.1074/jbc.M117.798405. Epub 2017 Jun 19. 10.1074/jbc.M117.798405 PubMed 28630042