Skip to main content
Addgene
Open Menu

pcDNA3.1-mGreenLantern
(Plasmid #161912)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161912 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 161912-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 161912-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5410
  • Total vector size (bp) 6130
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mGreenLantern
  • Alt name
    mGL
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-mGreenLantern was a gift from Gregory Petsko (Addgene plasmid # 161912 ; http://n2t.net/addgene:161912 ; RRID:Addgene_161912)

  • For your References section:

    mGreenLantern: a bright monomeric fluorescent protein with rapid expression and cell filling properties for neuronal imaging. Campbell BC, Nabel EM, Murdock MH, Lao-Peregrin C, Tsoulfas P, Blackmore MG, Lee FS, Liston C, Morishita H, Petsko GA. Proc Natl Acad Sci U S A. 2020 Dec 1;117(48):30710-30721. doi: 10.1073/pnas.2000942117. Epub 2020 Nov 18. 10.1073/pnas.2000942117 PubMed 33208539
Related items:
Commonly requested with: