IBMc097
(Plasmid
#161945)
-
PurposeContains Type IIS restriction site free elements for IBM staging vectors. Staging plasmid for IBM on mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161945 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSB1C3(BsmBI-)
-
Backbone manufacturerBaojun Wang's Lab
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepSB1C3(BsmBI-)-BsaI-mCherry*(27-218)-BsaI
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer VF2 - TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer VR - ATTACCGCCTTTGAGTGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
IBMc097 was a gift from Baojun Wang (Addgene plasmid # 161945 ; http://n2t.net/addgene:161945 ; RRID:Addgene_161945) -
For your References section:
A systematic approach to inserting split inteins for Boolean logic gate engineering and basal activity reduction. Ho TYH, Shao A, Lu Z, Savilahti H, Menolascina F, Wang L, Dalchau N, Wang B. Nat Commun. 2021 Apr 13;12(1):2200. doi: 10.1038/s41467-021-22404-9. 10.1038/s41467-021-22404-9 PubMed 33850130