Skip to main content

pQE30-HypocratesCS
(Plasmid #161957)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161957 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQE-30
  • Backbone size w/o insert (bp) 3425
  • Total vector size (bp) 4772
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HypocratesCS
  • Species
    Synthetic
  • Insert Size (bp)
    1347
  • Mutation
    changed cysteine 355 to serine
  • Promoter T5
  • Tag / Fusion Protein
    • 6xHIs tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GCTTTGTGAGCGGATAACA
  • 3′ sequencing primer CCGAGCGTTCTGAACAAATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2021.02.22.432222 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQE30-HypocratesCS was a gift from Dmitry Bilan (Addgene plasmid # 161957 ; http://n2t.net/addgene:161957 ; RRID:Addgene_161957)
  • For your References section:

    Hypocrates is a genetically encoded fluorescent biosensor for (pseudo)hypohalous acids and their derivatives. Kostyuk AI, Tossounian MA, Panova AS, Thauvin M, Raevskii RI, Ezerina D, Wahni K, Van Molle I, Sergeeva AD, Vertommen D, Gorokhovatsky AY, Baranov MS, Vriz S, Messens J, Bilan DS, Belousov VV. Nat Commun. 2022 Jan 10;13(1):171. doi: 10.1038/s41467-021-27796-2. 10.1038/s41467-021-27796-2 PubMed 35013284