pQE30-HypocratesCS
(Plasmid #161957)

• Purpose: Bacterial expression of inactivated control version of genetically encoded biosensor for (pseudo)hypohalous acids and their derivatives
• Depositing Lab: Dmitry Bilan
• Publication: Kostyuk et al Nat Commun. 2022 Jan 10;13(1):171. doi: 10.1038/s41467-021-27796-2.

Backbone

• Vector backbone: pQE-30
• Backbone size w/o insert (bp): 3425
• Total vector size (bp): 4772
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: HypocratesCS
• Species: Synthetic
• Insert Size (bp): 1347
• Mutation: changed cysteine 355 to serine
• Promoter: T5
• Tag / Fusion Protein:
  • 6xHIs tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GCTTTGTGAGCGGATAACA
• 3′ sequencing primer: CCGAGCGTTCTGAACAAATC

Resource Information

• Supplemental Documents:
  • pQE30-HypocratesCS.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2021.02.22.432222 for bioRxiv preprint.