PB-Ostir-neo
(Plasmid
#161973)
-
PurposeExpresses Ostir and G418 resistance gene in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161973 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePB
-
Backbone manufacturersystem biosciences
- Backbone size w/o insert (bp) 6772
- Total vector size (bp) 9251
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOstir-3xHA-p2a-neoR
-
SpeciesSynthetic
-
Insert Size (bp)2670
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGCTGTCTCATCATTTTGGCAAA
- 3′ sequencing primer GGCAAACAACAGATGGCTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-Ostir-neo was a gift from Joanna Wysocka (Addgene plasmid # 161973 ; http://n2t.net/addgene:161973 ; RRID:Addgene_161973) -
For your References section:
Opposing Effects of Cohesin and Transcription on CTCF Organization Revealed by Super-resolution Imaging. Gu B, Comerci CJ, McCarthy DG, Saurabh S, Moerner WE, Wysocka J. Mol Cell. 2020 Nov 19;80(4):699-711.e7. doi: 10.1016/j.molcel.2020.10.001. Epub 2020 Oct 21. 10.1016/j.molcel.2020.10.001 PubMed 33091336