Skip to main content

PX458-mcherry
(Plasmid #161974)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161974 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PX458
  • Backbone size w/o insert (bp) 4218
  • Total vector size (bp) 9280
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9-t2a-mcherry
  • Species
    Streptococcus pyogene
  • Insert Size (bp)
    5052
  • Promoter Cbh

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AAGGGATGGTTGGTTGGTGG
  • 3′ sequencing primer GGCAAACAACAGATGGCTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX458-mcherry was a gift from Joanna Wysocka (Addgene plasmid # 161974 ; http://n2t.net/addgene:161974 ; RRID:Addgene_161974)
  • For your References section:

    Opposing Effects of Cohesin and Transcription on CTCF Organization Revealed by Super-resolution Imaging. Gu B, Comerci CJ, McCarthy DG, Saurabh S, Moerner WE, Wysocka J. Mol Cell. 2020 Nov 19;80(4):699-711.e7. doi: 10.1016/j.molcel.2020.10.001. Epub 2020 Oct 21. 10.1016/j.molcel.2020.10.001 PubMed 33091336