-
PurposeExpresses Cas9-p2a-mcherry (BbsI site silenced) and sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161974 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePX458
- Backbone size w/o insert (bp) 4218
- Total vector size (bp) 9280
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9-t2a-mcherry
-
SpeciesStreptococcus pyogene
-
Insert Size (bp)5052
- Promoter Cbh
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AAGGGATGGTTGGTTGGTGG
- 3′ sequencing primer GGCAAACAACAGATGGCTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX458-mcherry was a gift from Joanna Wysocka (Addgene plasmid # 161974 ; http://n2t.net/addgene:161974 ; RRID:Addgene_161974) -
For your References section:
Opposing Effects of Cohesin and Transcription on CTCF Organization Revealed by Super-resolution Imaging. Gu B, Comerci CJ, McCarthy DG, Saurabh S, Moerner WE, Wysocka J. Mol Cell. 2020 Nov 19;80(4):699-711.e7. doi: 10.1016/j.molcel.2020.10.001. Epub 2020 Oct 21. 10.1016/j.molcel.2020.10.001 PubMed 33091336