Skip to main content

pET28a-λN-βLac
(Plasmid #162039)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162039 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28a
  • Backbone size w/o insert (bp) 5207
  • Total vector size (bp) 6146
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Grow in BL21 for protein expression at 25ºC after induction with IPTG
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    λN domain of the λ phage and a β-lactamase fusion protein
  • Alt name
    λN-βLac
  • Species
    Synthetic
  • Insert Size (bp)
    939
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggtgatgtcggcgatatagg
  • 3′ sequencing primer gctagttattgctcagcgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-λN-βLac was a gift from Karen Polizzi (Addgene plasmid # 162039 ; http://n2t.net/addgene:162039 ; RRID:Addgene_162039)
  • For your References section:

    Low-cost and user-friendly biosensor to test the integrity of mRNA molecules suitable for field applications. Moya Ramirez I, Kontoravdi C, Polizzi KM. Biosens Bioelectron. 2019 Jul 15;137:199-206. doi: 10.1016/j.bios.2019.05.008. Epub 2019 May 7. 10.1016/j.bios.2019.05.008 PubMed 31100599
Commonly requested with: