pET28a-λN-βLac
(Plasmid
#162039)
-
PurposeExpresion of the fusion protein of the λN domain of the λ phage and ampR gene (encoding the enzyme β-lactamase without the native signal sequence)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162039 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET28a
- Backbone size w/o insert (bp) 5207
- Total vector size (bp) 6146
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrow in BL21 for protein expression at 25ºC after induction with IPTG
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameλN domain of the λ phage and a β-lactamase fusion protein
-
Alt nameλN-βLac
-
SpeciesSynthetic
-
Insert Size (bp)939
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggtgatgtcggcgatatagg
- 3′ sequencing primer gctagttattgctcagcgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-λN-βLac was a gift from Karen Polizzi (Addgene plasmid # 162039 ; http://n2t.net/addgene:162039 ; RRID:Addgene_162039) -
For your References section:
Low-cost and user-friendly biosensor to test the integrity of mRNA molecules suitable for field applications. Moya Ramirez I, Kontoravdi C, Polizzi KM. Biosens Bioelectron. 2019 Jul 15;137:199-206. doi: 10.1016/j.bios.2019.05.008. Epub 2019 May 7. 10.1016/j.bios.2019.05.008 PubMed 31100599