pET28a-B4E
(Plasmid
#162067)
-
PurposeFor expresion of the B4E fusion protein, consists of the ampR gene (encoding the enzyme β-lactamase without the native signal sequence) fused to residues 28-215 of the murine eIF4E
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162067 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET28a
- Backbone size w/o insert (bp) 5207
- Total vector size (bp) 6734
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrow in BL21 for protein expression at 25ºC after induction with IPTG
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameampR-eIF4E fusion protein
-
Alt nameB4E
-
SpeciesSynthetic; E.coli
-
Insert Size (bp)1527
-
MutationeIF4E incorporating the K119A mutation, which is known to increase the cap binding affinity of the protein
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggtgatgtcggcgatatagg
- 3′ sequencing primer gctagttattgctcagcgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-B4E was a gift from Karen Polizzi (Addgene plasmid # 162067 ; http://n2t.net/addgene:162067 ; RRID:Addgene_162067) -
For your References section:
High resolution biosensor to test the capping level and integrity of mRNAs. Moya-Ramirez I, Bouton C, Kontoravdi C, Polizzi K. Nucleic Acids Res. 2020 Dec 16;48(22):e129. doi: 10.1093/nar/gkaa955. 10.1093/nar/gkaa955 PubMed 33152073