-
PurposeCompact Cre expression vector with modified PPT designed to generate high-titer non-integrating lentivirus when packaged with PsPax2-D64V (Addgene #63586)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162073 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLX311
-
Backbone manufacturerBroad Institute
- Backbone size w/o insert (bp) 8500
- Total vector size (bp) 7398
-
Modifications to backboneEF1a promoter replaced with shortened EFS promoter, deletion in U3-PPT (described in Kantor et al., 2011)
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCre
-
SpeciesSynthetic
-
Insert Size (bp)1032
-
Mutationcodon-optimized for expression in M. musculus
- Promoter EFS (part of insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NsiI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer ggaattggtttaacataacaaattggctgtgg
- 3′ sequencing primer WPRE-R (CATAGCGTAAAAGGAGCAACA);
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX_EFS-Cre_ppt-del was a gift from Robert Manguso (Addgene plasmid # 162073 ; http://n2t.net/addgene:162073 ; RRID:Addgene_162073) -
For your References section:
In vivo screens using a selective CRISPR antigen removal lentiviral vector system reveal immune dependencies in renal cell carcinoma. Dubrot J, Lane-Reticker SK, Kessler EA, Ayer A, Mishra G, Wolfe CH, Zimmer MD, Du PP, Mahapatra A, Ockerman KM, Davis TGR, Kohnle IC, Pope HW, Allen PM, Olander KE, Iracheta-Vellve A, Doench JG, Haining WN, Yates KB, Manguso RT. Immunity. 2021 Jan 20. pii: S1074-7613(21)00001-7. doi: 10.1016/j.immuni.2021.01.001. 10.1016/j.immuni.2021.01.001 PubMed 33497609