pHiFi Cas9-2×sgRNA (empty, donor)
(Plasmid
#162277)
-
PurposeAll-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains BPNLS-HiFi Cas9-BPNLS and two sgRNA expression cassettes.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162277 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepeSpCas9(1.1)-2×sgRNA (empty, donor)
-
Backbone manufacturerKazuhisa Nakayama lab (Plasmid #80768)
- Backbone size w/o insert (bp) 4663
-
Modifications to backboneThe eSpCas9(1.1) was replaced with the HiFi Cas9.
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHiFi Cas9
-
Alt nameSpCas9 (R691A)
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4359
-
MutationSpCas9 (R691A)
-
Tags
/ Fusion Proteins
- BPNLS (N terminal on insert)
- BPNLS (C terminal on insert)
- FLAG tag (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGGGATGGTTGGTTGGTGGG
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe 1BPNLS-Cas9-1BPNLS portion of this plasmid utilized pCAG-1BPNLS-Cas9-1BPNLS (Plasmid #87108).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHiFi Cas9-2×sgRNA (empty, donor) was a gift from Kazuhisa Nakayama (Addgene plasmid # 162277 ; http://n2t.net/addgene:162277 ; RRID:Addgene_162277) -
For your References section:
ARL3 and ARL13B GTPases participate in distinct steps of INPP5E targeting to the ciliary membrane. Fujisawa S, Qiu H, Nozaki S, Chiba S, Katoh Y, Nakayama K. Biol Open. 2021 Aug 27. pii: 271969. doi: 10.1242/bio.058843. 10.1242/bio.058843 PubMed 34447983