Skip to main content
Addgene

pHiFi Cas9-2×sgRNA (empty, donor)
(Plasmid #162277)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162277 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    peSpCas9(1.1)-2×sgRNA (empty, donor)
  • Backbone manufacturer
    Kazuhisa Nakayama lab (Plasmid #80768)
  • Backbone size w/o insert (bp) 4663
  • Modifications to backbone
    The eSpCas9(1.1) was replaced with the HiFi Cas9.
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HiFi Cas9
  • Alt name
    SpCas9 (R691A)
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4359
  • Mutation
    SpCas9 (R691A)
  • Tags / Fusion Proteins
    • BPNLS (N terminal on insert)
    • BPNLS (C terminal on insert)
    • FLAG tag (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer AGGGATGGTTGGTTGGTGGG
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The 1BPNLS-Cas9-1BPNLS portion of this plasmid utilized pCAG-1BPNLS-Cas9-1BPNLS (Plasmid #87108).
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHiFi Cas9-2×sgRNA (empty, donor) was a gift from Kazuhisa Nakayama (Addgene plasmid # 162277 ; http://n2t.net/addgene:162277 ; RRID:Addgene_162277)
  • For your References section:

    ARL3 and ARL13B GTPases participate in distinct steps of INPP5E targeting to the ciliary membrane. Fujisawa S, Qiu H, Nozaki S, Chiba S, Katoh Y, Nakayama K. Biol Open. 2021 Aug 27. pii: 271969. doi: 10.1242/bio.058843. 10.1242/bio.058843 PubMed 34447983