pEPQD0CM0549
(Plasmid
#162300)
-
PurposeLevel 0 N-terminal tag part for MoClo assembly, CCAT-AATG
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162300 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTwist
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameN-terminal tag, SUMO-[TEV cleavage site]
-
SpeciesSynthetic
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GTTGTAAAACGACGGCCAGTC
- 3′ sequencing primer AGCGGATAACAATTTCACACAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEPQD0CM0549 was a gift from Nicola Patron (Addgene plasmid # 162300 ; http://n2t.net/addgene:162300 ; RRID:Addgene_162300) -
For your References section:
Biofoundry-assisted expression and characterization of plant proteins. Dudley QM, Cai YM, Kallam K, Debreyne H, Carrasco Lopez JA, Patron NJ. Synth Biol (Oxf). 2021 Sep 11;6(1):ysab029. doi: 10.1093/synbio/ysab029. eCollection 2021. 10.1093/synbio/ysab029 PubMed 34693026