Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #162302)


Item Catalog # Description Quantity Price (USD)
Plasmid 162302 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    N-terminal tag, [S-tag]-[TEV cleavage site]
  • Species

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ggcgtatcacgaggcagaatttc
  • 3′ sequencing primer CCTGCATAACGCGAAGTAATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEPQD0CM0281 was a gift from Nicola Patron (Addgene plasmid # 162302 ; ; RRID:Addgene_162302)
  • For your References section:

    Biofoundry-assisted expression and characterization of plant proteins. Dudley QM, Cai YM, Kallam K, Debreyne H, Carrasco Lopez JA, Patron NJ. Synth Biol (Oxf). 2021 Sep 11;6(1):ysab029. doi: 10.1093/synbio/ysab029. eCollection 2021. 10.1093/synbio/ysab029 PubMed 34693026