Skip to main content

pEPQD0CM0539
(Plasmid #162306)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162306 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTwist
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CDS, TEV protease (S219V), no stop codon
  • Species
    Synthetic
  • Mutation
    S219V, codon optimized for E. coli

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GTTGTAAAACGACGGCCAGTC
  • 3′ sequencing primer AGCGGATAACAATTTCACACAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEPQD0CM0539 was a gift from Nicola Patron (Addgene plasmid # 162306 ; http://n2t.net/addgene:162306 ; RRID:Addgene_162306)
  • For your References section:

    Biofoundry-assisted expression and characterization of plant proteins. Dudley QM, Cai YM, Kallam K, Debreyne H, Carrasco Lopez JA, Patron NJ. Synth Biol (Oxf). 2021 Sep 11;6(1):ysab029. doi: 10.1093/synbio/ysab029. eCollection 2021. 10.1093/synbio/ysab029 PubMed 34693026