iRFP-FRB1C-Cb5
(Plasmid
#162441)
-
Purposefor use in CIT (chemically induced trimerization) system
-
Depositing Lab
-
Depositing OrganizationJohns Hopkins University and School of Medicine
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162441 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 162441-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 162441-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneC1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiRFP-FRB1C-Cb5
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn1 (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 162441-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 162441-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
iRFP-FRB1C-Cb5 was a gift from Takanari Inoue (Addgene plasmid # 162441 ; http://n2t.net/addgene:162441 ; RRID:Addgene_162441) -
For your References section:
Rational design and implementation of a chemically inducible heterotrimerization system. Wu HD, Kikuchi M, Dagliyan O, Aragaki AK, Nakamura H, Dokholyan NV, Umehara T, Inoue T. Nat Methods. 2020 Sep;17(9):928-936. doi: 10.1038/s41592-020-0913-x. Epub 2020 Aug 3. 10.1038/s41592-020-0913-x PubMed 32747768