Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPPED
(Plasmid #162468)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 162468 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    p201N Cas9
  • Backbone size w/o insert (bp) 14349
  • Total vector size (bp) 18330
  • Vector type
    Plant Expression
  • Selectable markers
    kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Kanamycin, 25 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Cas9H840A
  • Species
    Synthetic
  • Insert Size (bp)
    10576
  • Mutation
    Change histidine 840 to Alanine based sequence on vector pMOD_A0301
  • Promoter 2x35S
  • Tag / Fusion Protein
    • MLV reverse transcriptase (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTAAGGGATGACGCACAATCC
  • 3′ sequencing primer ttcgaattcactgccgtc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    attR gateway destination cassette
  • Species
    Synthetic

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCAACTGACTGAAATGCCTCA
  • 3′ sequencing primer acatcaggttaatggcgt
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Dr. Ning Zhang from Dr. Gregory Martin lab made this vector.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Reference:
1) Targeted genome modifications in soybean with CRISPR/Cas9. Jacobs TB, LaFayette PR, Schmitz RJ, Parrott WA. BMC Biotechnology. 2015;15:16
2) A Multipurpose Toolkit to Enable Advanced Genome Engineering in Plants. Cermak, T.
Curtin, S. J., Gil-Humanes, J., Cegan, R., Kono, T. J. Y., Konecna, E., Belanto, J. J., Starker, C. G., Mathre, J. W., Greenstein, R. L., Voytas, D. F. Plant Cell. 2017; 29(6):1196-1217.
Please visit https://www.biorxiv.org/content/10.1101/2020.07.16.206276v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPPED was a gift from Adam Bogdanove (Addgene plasmid # 162468 ; http://n2t.net/addgene:162468 ; RRID:Addgene_162468)
  • For your References section:

    Spelling Changes and Fluorescent Tagging With Prime Editing Vectors for Plants. Wang L, Kaya HB, Zhang N, Rai R, Willmann MR, Carpenter SCD, Read AC, Martin F, Fei Z, Leach JE, Martin GB, Bogdanove AJ. Front Genome Ed. 2021 Mar 4;3:617553. doi: 10.3389/fgeed.2021.617553. eCollection 2021. 10.3389/fgeed.2021.617553 PubMed 34713247