-
PurposeDestination Expression vector for dicot plant prime editing
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162468 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep201N Cas9
- Backbone size w/o insert (bp) 14349
- Total vector size (bp) 18330
-
Vector typePlant Expression
-
Selectable markerskanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Kanamycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCas9H840A
-
SpeciesSynthetic
-
Insert Size (bp)10576
-
MutationChange histidine 840 to Alanine based sequence on vector pMOD_A0301
- Promoter 2x35S
-
Tag
/ Fusion Protein
- MLV reverse transcriptase (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAAGGGATGACGCACAATCC
- 3′ sequencing primer ttcgaattcactgccgtc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameattR gateway destination cassette
-
SpeciesSynthetic
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GCAACTGACTGAAATGCCTCA
- 3′ sequencing primer acatcaggttaatggcgt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDr. Ning Zhang from Dr. Gregory Martin lab made this vector.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Reference:
1) Targeted genome modifications in soybean with CRISPR/Cas9. Jacobs TB, LaFayette PR, Schmitz RJ, Parrott WA. BMC Biotechnology. 2015;15:16
2) A Multipurpose Toolkit to Enable Advanced Genome Engineering in Plants. Cermak, T.
Curtin, S. J., Gil-Humanes, J., Cegan, R., Kono, T. J. Y., Konecna, E., Belanto, J. J., Starker, C. G., Mathre, J. W., Greenstein, R. L., Voytas, D. F. Plant Cell. 2017; 29(6):1196-1217.
Please visit https://www.biorxiv.org/content/10.1101/2020.07.16.206276v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPPED was a gift from Adam Bogdanove (Addgene plasmid # 162468 ; http://n2t.net/addgene:162468 ; RRID:Addgene_162468) -
For your References section:
Spelling Changes and Fluorescent Tagging With Prime Editing Vectors for Plants. Wang L, Kaya HB, Zhang N, Rai R, Willmann MR, Carpenter SCD, Read AC, Martin F, Fei Z, Leach JE, Martin GB, Bogdanove AJ. Front Genome Ed. 2021 Mar 4;3:617553. doi: 10.3389/fgeed.2021.617553. eCollection 2021. 10.3389/fgeed.2021.617553 PubMed 34713247