Cip-pAct1-Mnase-SAT1
(Plasmid
#162557)
-
PurposeFor the C. auris MNase control strain, the URA3 auxotrophy marker of the CIp-pACT1-3xFLAG-MNase-SV40-CYC was replaced by SAT1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162557 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneCip-Act1-Cyc
- Backbone size w/o insert (bp) 6740
- Total vector size (bp) 7301
-
Vector typeYeast Expression
-
Selectable markersSAT1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name3FLAG-Mnase-SV40
-
SpeciesSynthetic
-
Insert Size (bp)561
- Promoter Actine
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MLuI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer AGGGTTTTCCCAGTCACG
- 3′ sequencing primer GAGCGGATAACAATTTCACAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cip-pAct1-Mnase-SAT1 was a gift from Adnane Sellam (Addgene plasmid # 162557 ; http://n2t.net/addgene:162557 ; RRID:Addgene_162557) -
For your References section:
High-Resolution Genome-Wide Occupancy in Candida spp. Using ChEC-seq. Tebbji F, Khemiri I, Sellam A. mSphere. 2020 Oct 14;5(5). pii: 5/5/e00646-20. doi: 10.1128/mSphere.00646-20. 10.1128/mSphere.00646-20 PubMed 33055256